问题
I want to convert the following line of a file into JSON, I want to save that into an mongoose schema.
>HWI-ST700660_96:2:1101:1455:2154#5@0/1
GAA…..GAATG
Should be:
{“>HWI-ST700660_96:2:1101:1455:2154#5@0/1”: “GAA…..GAATG”}
I have tried several options, one sample below, but no success, any suggestion?
const parser = require("csv-parse/lib/sync");//import parser
const fs = require("fs");//import file reader
const path = require("path");//for join paths
const sourceData = fs.readFileSync(path.join(__dirname, "Reads.txt"), "utf8");//read the file, locally stored
console.log(sourceData);//print out for checking
const documents = parser(sourceData);//parsing, it works for other situations I have tested, in a column like data
console.log(documents);//printing out
This code give me an output as following:
[ [ '>HWI-ST700660_96:2:1101:1455:2154#5@0/1' ],
[ 'GAATGGAATGAAATGGATAGGAATGGAATGGAATGGAATGGATTGGAATGGATTAGAATGGATTGGAATGGAATGAAATTAATTTGATTGGAATGGAATG' ],...
Similar question: fasta file reading python
回答1:
Because you are using the default config of the parser, it does simply output arrays of arrays in that configuration. If you want to receive objects you will need to give the parser some options (columns) first. Take a look at the doc.
When using the sync parsing mode (like you are using) you can provide options like this:
const documents = parse(sourceData, {columns: true})
columns:true will infer the column names from the first line of the input csv.
来源：https://stackoverflow.com/questions/60545123/reading-an-fasta-file