complement

All answers I seem to find on how to find the 1s (flip the bits of the positive) and the 2s (flip the bits of the positive binary and add 1) complement doesn't seem to answer my question. My homework assignment asks to find the complement of a negative number.. So instead of starting out with a positive, and needed to find out what its negative is, I am given a negative number and asked to find its complement. One silly thought is, do I find the positive value binary value, then flip the bits to get my negative number, then flip it again to find my 1s complement of the negative number?? It

I'm trying to wrap my head around overflow within twos complement for example say I'm trying to take away these two binary numbers: 1111 1000 0100 - 010 111 001 000 I convert the 2nd binary number to it's two complement equivalent and then simply add it but I noticed it resulted in an overflow of 1, do I simply ignore the overflow? or is there a rule I must follow 1111 1000 0100 + 1010 0011 1000 = (1) 1001 1011 1100 Short answer: if you are performing arithmetic on fixed-width binary numbers, using two's complement representation for negative numbers, then yes, you ignore the one-bit overflow.

Suppose I have a DNA sequence. I want to get the complement of it. I used the following code but I am not getting it. What am I doing wrong ? s=readline() ATCTCGGCGCGCATCGCGTACGCTACTAGC p=unlist(strsplit(s,"")) h=rep("N",nchar(s)) unlist(lapply(p,function(d){ for b in (1:nchar(s)) { if (p[b]=="A") h[b]="T" if (p[b]=="T") h[b]="A" if (p[b]=="G") h[b]="C" if (p[b]=="C") h[b]="G" } Use chartr which is built for this purpose: > s [1] "ATCTCGGCGCGCATCGCGTACGCTACTAGC" > chartr("ATGC","TACG",s) [1] "TAGAGCCGCGCGTAGCGCATGCGATGATCG" Just give it two equal-length character strings and your string. Also

I have two collections of type ICollection<MyType> called c1 and c2 . I'd like to find the set of items that are in c2 that are not in c1 , where the heuristic for equality is the Id property on MyType . What is the quickest way to perform this in C# (3.0)? Use Enumerable.Except and specifically the overload that accepts an IEqualityComparer<MyType> : var complement = c2.Except(c1, new MyTypeEqualityComparer()); Note that this produces the set difference and thus duplicates in c2 will only appear in the resulting IEnumerable<MyType> once. Here you need to implement IEqualityComparer<MyType> as

Is two's complement notation of a positive number is same as its binary representation? Is two's complement notation of a positive number the same number? The good example is from wiki that the relationship to two's complement is realized by noting that 256 = 255 + 1, and (255 − x) is the ones' complement of x 0000 0111=7 two's complement is 1111 1001= -7 the way it works is the msb(most significant bit) receives a negative value so in the case above -7 = 1001= -8 + 0+ 0+ 1 Edit- A positive number written in two's-complement notation is the same as the number written in unsigned notation

In chapter 2, the section on bitwise operators (section 2.9), I'm having trouble understanding how one of the sample methods works. Here's the method provided: unsigned int getbits(unsigned int x, int p, int n) { return (x >> (p + 1 - n)) & ~(~0 << n); } The idea is that, for the given number x , it will return the n bits starting at position p , counting from the right (with the farthest right bit being position 0). Given the following main() method: int main(void) { int x = 0xF994, p = 4, n = 3; int z = getbits(x, p, n); printf("getbits(%u (%x), %d, %d) = %u (%X)\n", x, x, p, n, z, z);