“average length of the sequences in a fasta file”: Can you improve this Erlang code?

Question

I\'m trying to get the mean length of fasta sequences using Erlang. A fasta file looks like this

>title1
ATGACTAGCTAGCAGCGATCGACCGTCGTACGC
AT         


        

Answer 1

Did you try Elixir (elixir-lang.org) which is runs on top of Erlang and has a syntax similar to Ruby. Elixir solves String problems in the following way:

Elixir strings are UTF8 binaries, with all the raw speed and memory savings that brings. Elixir has a String module with Unicode functionality built-in and is a great example of writing code that writes code. String.Unicode reads various Unicode database dumps such as UnicodeData.txt to dynamically generate Unicode functions for the String module built straight from that data! (http://devintorr.es/blog/2013/01/22/the-excitement-of-elixir/)

Just wonder whether Elixir would be faster?