“average length of the sequences in a fasta file”: Can you improve this Erlang code?

Question

I\'m trying to get the mean length of fasta sequences using Erlang. A fasta file looks like this

>title1
ATGACTAGCTAGCAGCGATCGACCGTCGTACGC
AT         


        

Answer 1

The call string:len(string:strip(L)) traverses the list at least twice (I'm unaware of the string:strip implementation). Instead you could write a simple function to count the line length w/0 the spaces:

stripped_len(L) ->
  stripped_len(L, 0).

stripped_len([$ |L], Len) ->
  stripped_len(L, Len);

stripped_len([_C|L], Len) ->
  stripped_len(L, Len + 1);

stripped_len([], Len) ->
  Len.

The same method can be applied to binaries as well.